Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
cir-ITCH | |||
Gene | ITCH | Organism | Human |
Genome Locus | chr20:33001547-33037285:+ | Build | hg19 |
Disease | Colorectal Cancer | ICD-10 | Malignant neoplasm of rectosigmoid junction (C19) |
DBLink | Link to database | PMID | 26110611 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Colorectal Cancer tissues and corresponding paracancerous tissue samples |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GCAGAGGCCAACACTGGAA ReverseTCCTTGAAGCTGACTACGCTGAG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Huang, G, Zhu, H, Shi, Y, Wu, W, Cai, H, Chen, X (2015). cir-ITCH plays an inhibitory role in colorectal cancer by regulating the Wnt/β-catenin pathway. PLoS ONE, 10, 6:e0131225. |